PD-1 CRISPR/Cas9 Lentivirus (Integrating)
The binding of Programmed Cell Death Protein 1 (PD-1), a receptor expressed on activated T-cells, to its ligands PD-L1 and PD-L2, negatively regulates immune responses. PD-1 ligands are found on most cancer cells, and the PD-1:PD-L1/2 interaction inhibits T cell activity and enables cancer cells to escape immune surveillance. The PD-1:PD-L1/2 pathway is also involved in regulating autoimmune responses, making these proteins promising therapeutic targets for a number of cancer types, as well as multiple sclerosis, arthritis, lupus, and type I diabetes.
The PD-1 CRISPR Lentiviruses are replication incompetent, HIV-based VSV-G pseudo-typed lentiviral particles that are ready to be transduced into almost all types of mammalian cells, including primary and non-dividing cells. The pseudovirus particles contain a CRISPR/Cas9 gene driven by an EF1A promoter, along with 4 sgRNA (single guide RNA) targeting human PD-1 (Programmed Cell Death 1, PDCD1, CD279, GenBank Accession #NM_005018) driven by a U6 promoter (Figures 1 and 2).
The DNA transduced by the integrating lentivirus integrates randomly into the cellular genome to express both Cas9 and sgRNA. Puromycin selection increases the knockout efficiency by forcing high expression levels of both Cas9 and the sgRNA, and can be used with the integrating lentivirus to quickly and easily achieve high knockdown efficiencies in a cell pool. Efficiencies also depend on the cell type and the gene of interest.
Figure 1. Schematic of the Lenti-vector used to generate the PD-1 CRISPR/Cas9 Lentivirus.
| Gene Target | Primer ID: | sgRNA Sequence |
| PD-1 | PD-1-1 | CGTGTCACACAACTGCCCAA |
| PD-1 | PD-1-2 | GCCCACGACACCAACCACCA |
| PD-1 | PD-1-3 | CCCTTCGGTCACCACGAGCA |
| PD-1 | PD-1-4 | CACCTACCTAAGAACCATCC |
Figure 2: List of sgRNA Sequences in the PD-1 CRISPR/Cas9 Lentivirus.
The lentivirus particles were produced from HEK293T cells. They are supplied in cell culture medium containing 90% DMEM + 10% FBS.
Powered by Bioz
San Diego, CA 92121
858-202-1401
Products are for Research Use Only
COMPANY
Copyright © 2024
BPS Bioscience, Inc.
All rights reserved.
Diagrams on this website are created with BioRender.com.