BCMA CRISPR/Cas9 Lentivirus (Integrating)
The BCMA CRISPR/Ca9 Lentiviruses are replication incompetent, HIV-based, VSV-G pseudo-typed lentiviral particles that are ready to transduce most mammalian cells, including primary and non-dividing cells. These viruses contain a CRISPR/Cas9 gene, driven by an EF1A promoter, and 5 sgRNA (single guide RNA) targeting human BCMA (B-cell maturation antigen) driven by a U6 promoter (see Table 1 for sgRNA sequences). The integrating lentivirus integrates randomly into the cell’s genome to express both the Cas9 and sgRNAs. Simultaneous expression of Cas9 and BCMA sgRNA allows the generation of BCMA-knockout cells with one single transduction step. The lentiviruses also contain a puromycin selection marker (Figure 1).
Figure 1. Schematic of the lenti-vector used to generate the BCMA CRISPR/Cas9 Lentivirus.
Table 1: List of sgRNA sequences in the BCMA CRISPR/Cas9 Lentivirus.
Gene Target: | Primer ID: | sgRNA Sequence: |
TNFRSF17 (BCMA) | TNFRSF17-1 | CCTCTAACATGTCAGCGTTA |
TNFRSF17 (BCMA) | TNFRSF17-2 | TGTCAACTTCGATGTTCTTC |
TNFRSF17 (BCMA) | TNFRSF17-3 | CGAGTACACGGTGGAAGAAT |
TNFRSF17 (BCMA) | TNFRSF17-4 | TTCACTGAATTGGTCACACC |
TNFRSF17 (BCMA) | TNFRSF17-5 | GTGTTTTTAAACTCGTCCTT |
Note: BPS Bioscience also offers a non-integrating version of this product (BPS Bioscience #78894).
The lentivirus particles were produced from HEK293T cells. They are supplied in cell culture medium containing 90% DMEM + 10% FBS. Virus particles can be packaged in custom formulations by special request, for an additional fee.
B-cell maturation antigen (BCMA), also known as CD269 or tumor necrosis factor receptor superfamily member 17 (TNFRSF17), is a cell surface receptor of the TNF receptor superfamily that recognizes B-cell activating factor (BAFF) and is involved in B cell proliferation and maturation. BCMA is preferentially expressed in mature B lymphocytes and the soluble form of BCMA can be found at higher levels in the serum of Multiple Myeloma (MM) patients. BCMA is a highly attractive target antigen for immunotherapy. BCMA, similarly to CD19, is restricted in expression to mature B cells, allowing the progenitor’s population to be spared during treatment and to replenish the patient’s B cell population. BMCA targeting therapies include bispecific antibodies, antibody-drug conjugates, and chimeric antigen receptor (CAR) T cells. To date, the FDA has approved two BCMA CAR-T therapies for the treatment of MM, that resulted in promising outcomes for patients. Further studies will allow a better understanding of the role of BCMA in cancer and fine tune cancer therapy tools.