The T Cell Receptor (TCR) is found on the surface of T-cells and is responsible for recognizing antigens bound to MHC (Major Histocompatibility Complex) molecules. Activation of the TCR results in activation of downstream NFAT signaling. The TCR consists of a heterodimer of two different protein chains, of which the alpha (α) and beta (β) chains are the predominant chains.
The TCR CRISPR Lentiviruses are replication incompetent, HIV-based VSV-G pseudo-typed lentiviral particles that are ready to be transduced into almost all types of mammalian cells, including primary and non-dividing cells. The particles contain a CRISPR/Cas9 gene driven by an EF1A promoter, along with 4 sgRNA (single guide RNA) targeting human TRAC (T-Cell Receptor Alpha Constant) and human TRBC1 (T-Cell Receptor Beta Constant 1) regions of the α and β chains.
The DNA transduced by the integrating lentivirus integrates randomly into the cellular genome to express both Cas9 and sgRNA. Puromycin selection increases the knockout efficiency by forcing high expression levels of both Cas9 and the sgRNA, and can be used with the integrating lentivirus to quickly and easily achieve high knockdown efficiencies in a cell pool. Efficiencies also depend on the cell type and the gene of interest.
Figure 1: Schematic of the Lenti-vector used to generate the TCR CRISPR/Cas9 Lentivirus.
Gene Target
Primer ID:
sgRNA Sequence
TRAC
TCR-1
AGAGTCTCTCAGCTGGTACA
TRAC
TCR-2
TGTGCTAGACATGAGGTCTA
TRBC1
TCR-3
GGAGAATGACGAGTGGACCC
TRBC1
TCR-4
GCAGTATCTGGAGTCATTGA
Figure 2: List of sgRNA Sequences in the TCR CRISPR/Cas9 Lentivirus.
Two vials (500 μl x 2) of lentivirus at a titer ≥1 x 106 TU/ml. The titer will vary with each lot; the exact value is provided with each shipment.
Formulation
The lentivirus particles were produced from HEK293T cells. They are supplied in cell culture medium containing 90% DMEM + 10% FBS.
Storage/Stability
Lentiviruses are shipped with dry ice. For long-term storage, it is recommended to store the lentiviruses at -80°C for up to 12 months from date of receipt. Avoid repeated freeze/thaw cycles. Titers can drop significantly with each freeze/thaw cycle.
Instructions for Use
See assay protocol for detailed instructions.
Applications
Transient knock-down of TCR in target cells.
Generation of a stable TCR knock-out cell line following puromycin selection.
Shipping Temperature
-80°C
Notes
The CRISPR/CAS9 technology is covered under numerous patents, including U.S. Patent Nos. 8,697,359 and 8,771,945, as well as corresponding foreign patents applications, and patent rights.
Biosafety The lentiviruses are produced with the SIN (self-inactivation) lentivector which ensures self-inactivation of the lentiviral construct after transduction and after integration into the genomic DNA of the target cells. None of the HIV genes (gag, pol, rev) will be expressed in the transduced cells, as they are expressed from packaging plasmids lacking the packing signal and are not present in the lentivirus particle. Although the pseudotyped lentiviruses are replication-incompetent, they require the use of a Biosafety Level 2 facility. BPS Bioscience recommends following all local federal, state, and institutional regulations and using all appropriate safety precautions.