TCR CRISPR/Cas9 Lentivirus (Non-Integrating)
The T-Cell Receptor (TCR) is found on the surface of T-cells and is responsible for recognizing antigens bound to MHC (Major Histocompatibility Complex) molecules. Activation of the TCR results in activation of downstream NFAT signaling. The TCR consists of a heterodimer of two different protein chains, of which the alpha (α) and beta (β) chains are the predominant chains.
The TCR CRISPR Lentiviruses are replication incompetent, HIV-based VSV-G pseudo-typed lentiviral particles that are ready to be transduced into almost all types of mammalian cells, including primary and non-dividing cells. The particles contain a CRISPR/Cas9 gene driven by an EF1A promoter, along with 4 sgRNA (single guide RNA) targeting human TRAC (T-Cell Receptor Alpha Constant) and human TRBC1 (T-Cell Receptor Beta Constant 1) regions of the α and β chains.
The non-integrating lentivirus is made with a mutated integrase, resulting in only transient expression of the Cas9 and sgRNA. Although using the non-integrating lentivirus results in lower knockdown efficiency, the Cas9 isn’t permanently expressed, which lowers the risk of off-targeting, and there are no random integrations into the cell’s genome. Knockout cell lines can still be generated following cell sorting or limited dilution, because even though the Cas9 and sgRNA expression is transient, the changes in the genomic DNA from the Cas9 nuclease activity and NHEJ repair are permanent.
Figure 1. Schematic of the Lenti-vector used to generate the TCR CRISPR/Cas9 Lentivirus.
Gene Target | Primer ID: | sgRNA Sequence |
TRAC | TCR-1 | AGAGTCTCTCAGCTGGTACA |
TRAC | TCR-2 | TGTGCTAGACATGAGGTCTAA |
TRBC1 | TCR-3 | GGAGAATGACGAGTGGACCC |
TRBC1 | TCR-4 | GCAGTATCTGGAGTCATTGA |
Figure 2. List of sgRNA Sequences in the TCR CRISPR/Cas9 Lentivirus.
The lentiviruses were produced from HEK293T cells in medium containing 90% DMEM + 10% FBS.