TIGIT CRISPR/Cas9 Lentivirus (Integrating)
TIGIT (T-cell immunoreceptor with Ig and ITIM domains; VSTM3; VSIG9) is a co-inhibitory receptor that is highly expressed in Natural Killer (NK) cells and activated CD4+, CD8+, and regulatory T-cells. Interaction with the Poliovirus Receptor (PVR; CD155) on antigen presenting cells, such as dendritic cells, recruits either the Src homology (SH) domain-containing tyrosine phosphatases SHP1 and SHP2, or the Inositol phosphatase SHIP1 and SHIP2, to the TIGIT ITIM domain. This increases IL-10 release and suppresses NF-κB and NFAT T-cell receptor (TCR) signaling, which blocks T-cell proliferation and cytokine production. TIGIT also serves as a competitive inhibitor of CD226, a costimulatory receptor for CD155. TIGIT-targeting antibodies which block this T-cell intrinsic inhibitory effect have shown enhanced anti-tumor and anti-viral functions in preclinical studies.
The TIGIT CRISPR Lentiviruses are replication incompetent, HIV-based VSV-G pseudo-typed lentiviral particles that are ready to be transduced into almost all types of mammalian cells, including primary and non-dividing cells. The particles contain a CRISPR/Cas9 gene driven by an EF1A promoter, along with 4 sgRNA (single guide RNA) targeting human TIGIT (GenBank Accession #NM_173799) driven by a U6 promoter (Figures 1 and 2).
Figure 1. Schematic of the Lenti-vector used to generate the TIGIT CRISPR/Cas9 Lentivirus.
Gene Target: | Primer ID: | sgRNA Sequence |
TIGIT | TIGIT-1 | CATCTGCACAGCAGTCATCG |
TIGIT | TIGIT-2 | CAGGCACAATAGAAACAACG |
TIGIT | TIGIT-3 | GCTGACCGTGAACGATACAG |
TIGIT | TIGIT-4 | ACCCTGATGGGACGTACACT |
Figure 2. List of sgRNA Sequences in the TIGIT CRISPR/Cas9 Lentivirus.
The integrating lentivirus integrates randomly into the cell’s genome to express both the Cas9 and sgRNA. Puromycin selection increases the knockout efficiency by forcing high expression levels of both Cas9 and the sgRNA, and can be used with the integrating lentivirus to quickly and easily achieve high knockdown efficiencies in a cell pool. Efficiencies also depend on the cell type and the gene of interest.
The lentiviruses were produced from HEK293T cells in medium containing 90% DMEM + 10% FBS.