TIGIT CRISPR/Cas9 Lentivirus (Non-Integrating)
TIGIT (T-cell immunoreceptor with Ig and ITIM domains; VSTM3; VSIG9) is a co-inhibitory receptor that is highly expressed in Natural Killer (NK) cells and activated CD4+, CD8+, and regulatory T-cells. Interaction with the Poliovirus Receptor (PVR; CD155) on antigen presenting cells, such as dendritic cells, recruits either the Src homology (SH) domain-containing tyrosine phosphatases SHP1 and SHP2, or the Inositol phosphatase SHIP1 and SHIP2, to the TIGIT ITIM domain. This increases IL-10 release and suppresses NF-κB and NFAT T-cell receptor (TCR) signaling, which blocks T-cell proliferation and cytokine production. TIGIT also serves as a competitive inhibitor of CD226, a costimulatory receptor for CD155. TIGIT-targeting antibodies which block this T-cell intrinsic inhibitory effect have shown enhanced anti-tumor and anti-viral functions in preclinical studies.
The TIGIT CRISPR Lentiviruses are replication incompetent, HIV-based VSV-G pseudo-typed lentiviral particles that are ready to be transduced into almost all types of mammalian cells, including primary and non-dividing cells. The particles contain a CRISPR/Cas9 gene driven by an EF1A promoter, along with 4 sgRNA (single guide RNA) targeting human TIGIT (GenBank Accession #NM_173799) driven by a U6 promoter (Figures 1 and 2).
Figure 1. Schematic of the Lenti-vector used to generate the TIGIT CRISPR/Cas9 Lentivirus.
Gene Target: | Primer ID: | sgRNA Sequence |
TIGIT | TIGIT-1 | CATCTGCACAGCAGTCATCG |
TIGIT | TIGIT-2 | CAGGCACAATAGAAACAACG |
TIGIT | TIGIT-3 | GCTGACCGTGAACGATACAG |
TIGIT | TIGIT-4 | ACCCTGATGGGACGTACACT |
Figure 2. List of sgRNA Sequences in the TIGIT CRISPR/Cas9 Lentivirus.
Note: unlike human TIGIT CRISPR/Cas9 Lentivirus (Integrating) (BPS Bioscience, #78058), the human TIGIT CRISPR/Cas9 Lentivirus (Non-Integrating) is made with a mutated Integrase, resulting in only transient expression of the Cas9 and TIGIT targeting sgRNA. While this may minimize potential off-targeting risks due to either prolonged expression or integration of the Cas9, puromycin selection should not be used for more than 48 hours post-transduction, which may lower knockout efficiency.
The lentiviruses were produced from HEK293T cells in medium containing 90% DMEM + 10% FBS.