B2M (Human) CRISPR/Cas9 Lentivirus (Non-Integrating)
Beta-2 Microglobulin (B2M) is a required component of Major Histocompatibility Complex (MHC) class 1 molecules, which present peptide fragments from within the cell to cytotoxic T-cells as part of the adaptive immune system.
The B2M CRISPR/Cas9 Lentiviruses are replication incompetent, HIV-based, VSV-G pseudotyped lentiviral particles that are ready to infect almost all types of mammalian cells, including primary and non-dividing cells. The particles contain a CRISPR/Cas9 gene driven by an EF1A promoter, along with 5 sgRNA (single guide RNAs) targeting human B2M driven by a U6 promoter (Figures 1 and 2).
Note: unlike B2M CRISPR/Cas9 Lentivirus (Integrating) (BPS Bioscience, #78340), the B2M CRISPR/Cas9 Lentivirus (Non-Integrating) is made with a mutated Integrase, resulting in only transient expression of the Cas9 and B2M-targeting sgRNA.
It is expected that this will minimize potential off-target effects caused by either prolonged expression or random integration of Cas9 and the sgRNA. A short round of puromycin selection right after transduction may increase knockout efficiency, however puromycin should not be used for more than 48 hours post-transduction due to the transient nature of expression using the non-integrating lentivirus.
Figure 1. Schematic of the Lenti-vector used to generate the B2M CRISPR/Cas9 Lentivirus
Gene Target | sgRNA Sequence |
B2M | AAGTCAACTTCAATGTCGGA |
B2M | CTGAATCTTTGGAGTACCTG |
B2M | GAGTAGCGCGAGCACAGCTA |
B2M | TCCTGAATTGCTATGTGTCT |
B2M | GAAGTTGACTTACTGAAGAA |
Figure 2. List of sgRNA Sequences in the B2M CRISPR/Cas9 Lentivirus
The lentiviruses were produced from HEK293T cells in medium containing 90% DMEM + 10% FBS.