Beta-2 Microglobulin (B2M) is a required component of Major Histocompatibility Complex (MHC) class 1 molecules, which present peptide fragments from within the cell to cytotoxic T-cells as part of the adaptive immune system.
The B2M CRISPR/Cas9 Lentiviruses are replication incompetent, HIV-based, VSV-G pseudotyped lentiviral particles that are ready to infect almost all types of mammalian cells, including primary and non-dividing cells. The particles contain a CRISPR/Cas9 gene driven by an EF1A promoter, along with 5 sgRNA (single guide RNAs) targeting human B2M driven by a U6 promoter (Figures 1 and 2).
The integrating lentivirus integrates randomly into the cellular genome to express both Cas9 and the sgRNA. Puromycin selection forces high expression levels of both Cas9 and the sgRNA, and can be used with the integrating lentivirus to quickly and easily achieve high knockdown efficiencies in a cell pool. Efficiencies will depend on the cell type and the gene of interest.
Figure 1. Schematic of the Lenti-vector used to generate the B2M CRISPR/Cas9 Lentivirus
Gene Target
sgRNA Sequence
B2M
AAGTCAACTTCAATGTCGGA
B2M
CTGAATCTTTGGAGTACCTG
B2M
GAGTAGCGCGAGCACAGCTA
B2M
TCCTGAATTGCTATGTGTCT
B2M
GAAGTTGACTTACTGAAGAA
Figure 2. List of sgRNA Sequences in the B2M CRISPR/Cas9 Lentivirus
Two vials (500 µl x 2) of lentivirus at a titer ≥1 x 106 TU/ml. The titer will vary with each lot; the exact value is provided with each shipment.
Formulation
The lentiviruses were produced from HEK293T cells in medium containing 90% DMEM + 10% FBS.
Storage/Stability
Lentiviruses are shipped with dry ice. For long-term storage, it is recommended to store the lentiviruses at -80°C for up to 12 months from date of receipt. Avoid repeated freeze/thaw cycles. Titers can drop significantly with each freeze/thaw cycle.
Applications
1. Transient knock-down of B2M in target cells 2. Generation of a stable B2M knock-out cell pool following puromycin selection and limited dilution
Shipping Temperature
-80°C
Notes
The CRISPR/CAS9 technology is covered under numerous patents, including U.S. Patent Nos. 8,697,359 and 8,771,945, as well as corresponding foreign patents applications, and patent rights.
Avoid repeated freeze-thaw cycles. Titers can drop significantly with each freeze-thaw cycle.
Biosafety None of the HIV genes (gag, pol, rev) will be expressed in the transduced cells. Although the pseudotyped lentiviruses are replication-incompetent, they require the use of a Biosafety Level 2 facility. BPS recommends following all local federal, state, and institutional regulations and using all appropriate safety precautions.