NLRP3 CRISPR/Cas9 Lentivirus (Non-Integrating)
NLR family Pyrin domain containing 3 (NLRP3) is expressed in macrophages and is a component of inflammasomes. NLRP3 detects uric acid and extracellular ATP in damaged tissue and interacts with a pro-apoptotic protein that recruits caspases. This complex is also an upstream activator of NF-κB signaling and triggers an immune response as part of the innate immune system. Mutations in NLRP3 are known to cause autoinflammatory and neuroinflammatory diseases such as Alzheimer’s, Parkinson’s, and prion disease.
The NLRP3 CRISPR/Cas9 Lentiviruses are replication incompetent, HIV-based VSV-G pseudo-typed lentiviral particles ready to be transduced into most types of mammalian cells, including primary and non-dividing cells. The particles contain a CRISPR/Cas9 gene driven by an EF1A promoter, along with 5 sgRNA (single guide RNA) targeting human NLRP3 (Figure 1 and Table 1), allowing the knockdown of NLRP3 in transduced cells
The non-integrating lentivirus is made with a mutated integrase, resulting in only transient expression of the Cas9 and sgRNA. Although using the non-integrating lentivirus results in lower knockdown efficiency, the Cas9 protein is not permanently expressed, which lowers the risk of off-targeting, and there are no random integrations into the cell’s genome Despite transient expression of Cas9 and sgRNA, knockout cell lines can be generated using cell sorting or limiting dilution due to the permanent changes in the genomic DNA from the Cas9 nuclease activity and NHEJ repair.
Figure 1: Schematic of the lenti-vector used to generate the NLRP3 CRISPR/Cas9 Lentivirus.
Gene Target: | sgRNA Sequence: |
NLRP3 | GGTGCCTTTGACGAGCACAT |
NLRP3 | AAAAGAGATGAGCCGAAGTG |
NLRP3 | GTTCTATATCCACTGTCGAG |
NLRP3 | AGAGATTGATCTCAATCTTG |
NLRP3 | GAAGACAGGAATGCCCGTCT |
Table 1: List of sgRNA Sequences in the NLRP3 CRISPR/Cas9 Lentivirus.
The lentivirus particles were produced from HEK293T cells. They are supplied in cell culture medium containing 90% DMEM + 10% FBS.