Fc Gamma Receptor 2A (also known as CD32A, Fc-gamma-RIIa, FcgRIIa) is a low affinity Fc receptor for immunoglobulin G, encoded by the FCGR2A gene. Fc Gamma Receptor 2A is a cell surface receptor that is expressed on a variety of immune cells such as macrophages and neutrophils. It is involved in phagocytosis and in the clearing of spent immune complexes from the circulation. A polymorphism in FCGR2A has been associated with increased risks of nephritis and lupus.
The FCGR2A CRISPR/Cas9 Lentiviruses are replication incompetent, HIV-based VSV-G pseudo-typed lentiviral particles that are ready to transduce into almost all types of mammalian cells, including primary and non-dividing cells. The particles contain a CRISPR/Cas9 gene driven by an EF1A promoter, along with 5 sgRNA (single guide RNA) targeting human FCGR2A (Figure 1 and Table 1).
Figure 1: Schematic of the lenti-vector used to generate the FCGR2A CRISPR/Cas9 Lentivirus.
Gene Target:
sgRNA Sequence:
FCGR2A-1-F
TGGAGCACGTTGATCCACGG
FCGR2A-2-F
AGGGAGAAACCATCATGCTG
FCGR2A-3-F
GCTTGTGGGATGGAGAAGGT
FCGR2A-4-F
AGCAGCAGCAAAACTGTCAA
FCGR2A-5-F
AAAGCACAGTCAGATGCACA
Figure 2: List of sgRNA Sequences in the FCGR2A CRISPR/Cas9 Lentivirus.
●
Synonyms
FcGR-2A, CD32A, FcγRIIA, FCGRIIA
●
Product Data Gallery
Knockdown of FCGR2A in Jurkat cells using FCGR2A CRISPR/Cas9 Lentivirus
Two vials (500 µl x 2) of lentivirus at a titer ≥1 x 107 TU/ml. The titer will vary with each lot; the exact value is provided with each shipment.
Formulation
The lentivirus particles were produced from HEK293T cells. They are supplied in cell culture medium containing 90% DMEM + 10% FBS.
Storage/Stability
Lentiviruses are shipped with dry ice. For long-term storage, it is recommended to store the lentiviruses at -80°C for up to 12 months from date of receipt. Avoid repeated freeze/thaw cycles. Titers can drop significantly with each freeze/thaw cycle.
Applications
Transient knockdown of FCGR2A in target cells
Generation of a stable FCGR2A knockout cell line following puromycin selection and limiting dilution
Shipping Temperature
-80°C
Notes
The CRISPR/CAS9 technology is covered under numerous patents, including U.S. Patent Nos. 8,697,359 and 8,771,945, as well as corresponding foreign patents applications, and patent rights.
Biosafety The lentiviruses are produced with the SIN (self-inactivation) lentivector which ensures self-inactivation of the lentiviral construct after transduction and after integration into the genomic DNA of the target cells. None of the HIV genes (gag, pol, rev) will be expressed in the transduced cells, as they are expressed from packaging plasmids lacking the packing signal and are not present in the lentivirus particle. Although the pseudotyped lentiviruses are replication-incompetent, they require the use of a Biosafety Level 2 facility. BPS Bioscience recommends following all local federal, state, and institutional regulations and using all appropriate safety precautions.