FCGR2A CRISPR/Cas9 Lentivirus (Non-Integrating)
Fc Gamma Receptor 2A (also known as CD32A, Fc-gamma RIIa, FcgRIIa) is a low affinity Fc receptor for immunoglobulin G, encoded by the FCGR2A gene. Fc Gamma Receptor 2A is a cell surface receptor that is expressed on a variety of immune cells such as macrophages and neutrophils. It is involved in phagocytosis and in the clearing of spent immune complexes from the circulation. A polymorphism in FCGR2A has been associated with increased risks of nephritis and lupus.
The FCGR2A CRISPR/Cas9 Lentiviruses are replication incompetent, HIV-based VSV-G pseudotyped lentiviral particles that are ready to infect most types of mammalian cells, including primary and non-dividing cells. The particles contain a CRISPR/Cas9 gene driven by an EF1A promoter, along with 5 sgRNA (single guide RNA) targeting human FCGR2A (Figure 1 and Table 1).
The non-integrating lentivirus is made with a mutated integrase, resulting in only transient expression of Cas9 and sgRNA. Although using the non-integrating lentivirus results in lower knockdown efficiency, Cas9 is not permanently expressed, which lowers the risk of off-targeting, and there are no random integrations into the cell’s genome. Despite transient expression of Cas9 and sgRNA, knockout cell lines can still be generated using cell sorting or limiting dilution due to the permanent changes in the genomic DNA from the Cas9 nuclease activity and NHEJ repair.
Figure 1: Schematic of the lenti-vector used to generate the FCGR2A CRISPR/Cas9 Lentivirus.
Gene Target: | sgRNA Sequence: |
FCGR2A-1-F | TGGAGCACGTTGATCCACGG |
FCGR2A-2-F | AGGGAGAAACCATCATGCTG |
FCGR2A-3-F | GCTTGTGGGATGGAGAAGGT |
FCGR2A-4-F | AGCAGCAGCAAAACTGTCAA |
FCGR2A-5-F | AAAGCACAGTCAGATGCACA |
Figure 2: List of sgRNA Sequences in the FCGR2A CRISPR/Cas9 Lentivirus.
The lentivirus particles were produced from HEK293T cells. They are supplied in cell culture medium containing 90% DMEM + 10% FBS.