NLRP3 CRISPR/Cas9 Lentivirus (Integrating)
NLR family Pyrin domain containing 3 (NLRP3) is expressed in macrophages and is a component of inflammasomes. NLRP3 detects uric acid and extracellular ATP in damaged tissue and interacts with a pro-apoptotic protein that recruits caspases. This complex is also an upstream activator of NF-κB signaling and triggers an immune response as part of the innate immune system. Mutations in NLRP3 are known to cause autoinflammatory and neuroinflammatory diseases, such as Alzheimer’s, Parkinson’s, and prion disease.
The NLRP3 CRISPR/Cas9 Lentiviruses are replication incompetent, HIV-based VSV-G pseudo-typed lentiviral particles ready to infect most types of mammalian cells, including primary and non-dividing cells. The particles contain a CRISPR/Cas9 gene driven by an EF1A promoter, along with 5 sgRNA (single guide RNA) targeting human NLRP3 (Figure 1 and Table 1), allowing the knockdown of NLRP3 in transduced cells.
The DNA transduced by the integrating lentivirus integrates randomly into the cellular genome to express both Cas9 and sgRNA. Puromycin selection increases the knockout efficiency by forcing high expression levels of both Cas9 and the sgRNA, and can be used with the integrating lentivirus to quickly and easily achieve high knockdown efficiencies in a cell pool. Knockdown efficiencies also depend on the cell type.
Figure 1: Schematic of the lenti-vector used to generate the NLRP3 CRISPR/Cas9 Lentivirus.
| Gene Target: | sgRNA Sequence: |
| NLRP3 | GGTGCCTTTGACGAGCACAT |
| NLRP3 | AAAAGAGATGAGCCGAAGTG |
| NLRP3 | GTTCTATATCCACTGTCGAG |
| NLRP3 | AGAGATTGATCTCAATCTTG |
| NLRP3 | GAAGACAGGAATGCCCGTCT |
Table 1: List of sgRNA Sequences in the NLRP3 CRISPR/Cas9 Lentivirus.
The lentivirus particles were produced from HEK293T cells. They are supplied in cell culture medium containing 90% DMEM + 10% FBS.
Powered by Bioz
San Diego, CA 92121
858-202-1401
Products are for Research Use Only
COMPANY
Copyright © 2024
BPS Bioscience, Inc.
All rights reserved.
Diagrams on this website are created with BioRender.com.