LAG3 CRISPR/Cas9 Lentivirus (Non-Integrating)
Lymphocyte-activation gene 3 (LAG3, CD223) is a cell surface protein that belongs to the immunoglobulin (Ig) superfamily. LAG3 is expressed on activated T-cells, Natural Killer cells, B-cells, and plasmacytoid dendritic cells. Its main ligand is the MHC class II, to which it binds with higher affinity than CD4. It negatively regulates cellular proliferation, activation, and homeostasis of T-cells in a similar fashion as CTLA-4 and PD-1, and has been reported to play a role in T-reg suppressive function. A number of LAG3 antibodies are in preclinical development for the treatment of cancer and autoimmune disorders. LAG3 may be a better immune checkpoint inhibitor target than CTLA-4 or PD-1, because antibodies targeting CTLA-4 or PD-1 only activate effector T-cells while failing to inhibit T-reg activity, whereas an antagonist LAG3 antibody can both activate effector T-cells (by downregulating the LAG3 inhibiting signal) and inhibit induced (i.e. antigen-specific) T-reg suppressive activity.
The LAG3 CRISPR Lentiviruses are replication incompetent, HIV-based, VSV-G pseudo-typed lentiviral particles that are ready to be transduced into almost all types of mammalian cells, including primary and non-dividing cells. The particles contain a CRISPR/Cas9 gene driven by an EF1A promoter, along with 4 sgRNA (single guide RNA) targeting human LAG3 (GenBank Accession #NM_002286) driven by a U6 promoter (Figures 1 and 2).
Figure 1. Schematic of the Lenti-vector used to generate the LAG3 CRISPR/Cas9 Lentivirus.
Gene Target: | Primer ID: | sgRNA Sequence |
LAG3 | LAG3-1 | GTTCCGGAACCAATGCACAG |
LAG3 | LAG3-2 | GGGAGTTACCCAGAACAGTG |
LAG3 | LAG3-3 | CGTCCCGCCCCACATACTCG |
LAG3 | LAG3-4 | GCTCACATCCTCTAGTCGAA |
Figure 2. List of sgRNA Sequences in the LAG3 CRISPR/Cas9 Lentivirus.
Note: unlike Human LAG3 CRISPR/Cas9 Lentivirus (Integrating) (BPS Bioscience, #78053), the Human LAG3 CRISPR/Cas9 Lentivirus (Non-Integrating) is made with a mutated Integrase, resulting in only transient expression of the Cas9 and LAG3-targeting sgRNA. While this may minimize potential off-targeting risks due to either prolonged expression or integration of the Cas9, puromycin selection should not be used for more than 48 hours post-transduction, which may lower knockout efficiency.
The lentiviruses were produced from HEK293T cells in medium containing 90% DMEM + 10% FBS.