CRBN CRISPR/Cas9 Lentivirus (Non-Integrating)
Cereblon (CRBN) forms an E3 ubiquitin ligase complex which is responsible for ubiquitinating proteins that regulate various developmental processes. CRBN also binds to Calcium Activated Potassium Channel subunit alpha-1 (KCNMA1) to regulate ion transport. Moreover, mutations in CRBN may play an underlying role in tumor cells acquiring resistance to immunotherapy.
The CRBN CRISPR/Cas9 Lentiviruses are replication incompetent, HIV-based VSV-G pseudo-typed lentiviral particles that are ready to transduce into almost all types of mammalian cells, including primary and non-dividing cells. The particles contain a CRISPR/Cas9 gene driven by an EF1A promoter, along with 5 sgRNA (single guide RNA) targeting human CRBN.
The non-integrating lentivirus is made with a mutated integrase, resulting in only transient expression of the Cas9 and sgRNA. Although using the non-integrating lentivirus results in lower knockdown efficiency, the Cas9 isn’t permanently expressed, which lowers the risk of off-targeting, and there are no random integrations into the cell’s genome. Knockout cell lines can still be generated following cell sorting or limited dilution, because even though the Cas9 and sgRNA expression is transient, the changes in the genomic DNA from the Cas9 nuclease activity and NHEJ repair are permanent.
Figure 1: Schematic of the lenti-vector used to generate the CRBN CRISPR/Cas9 Lentivirus.
Gene Target: | sgRNA Sequence: |
CRBN | ACCAATGTTCATATAAATGG |
CRBN | CTGACTGTGTTCTTAGCTCA |
CRBN | TTACATACTGTATGTGATGT |
CRBN | TTCTAATTGAACTGCAGACA |
CRBN | TCAAGAAACAGCTACGTGAA |
Table 1: List of sgRNA Sequences in the CRBN CRISPR/Cas9 Lentivirus.
The lentivirus particles were produced from HEK293T cells. They are supplied in cell culture medium containing 90% DMEM + 10% FBS.