Cereblon (CRBN) forms an E3 ubiquitin ligase complex which is responsible for ubiquitinating proteins that regulate various developmental processes. CRBN also binds to Calcium Activated Potassium Channel subunit alpha-1 (KCNMA1) to regulate ion transport. Moreover, mutations in CRBN may play an underlying role in tumor cells acquiring resistance to immunotherapy.
The CRBN CRISPR/Cas9 Lentiviruses are replication incompetent, HIV-based VSV-G pseudotyped lentiviral particles that are ready to transduce almost all types of mammalian cells, including primary and non-dividing cells. The particles contain a CRISPR/Cas9 gene driven by an EF1A promoter, along with 5 sgRNA (single guide RNA) targeting human CRBN.
The DNA transduced by this lentivirus integrates randomly into the cellular genome to express both Cas9 and sgRNA. Puromycin selection increases the knockout efficiency by forcing high expression levels of both Cas9 and the sgRNA, and can be used with the integrating lentivirus to quickly and easily achieve high knockdown efficiencies in a cell pool. Efficiencies also depend on the cell type.
Figure 1: Schematic of the lenti-vector used to generate the CRBN CRISPR/Cas9 Lentivirus.
Gene Target:
sgRNA Sequence:
CRBN
ACCAATGTTCATATAAATGG
CRBN
CTGACTGTGTTCTTAGCTCA
CRBN
TTACATACTGTATGTGATGT
CRBN
TTCTAATTGAACTGCAGACA
CRBN
TCAAGAAACAGCTACGTGAA
Table 1: List of sgRNA Sequences in the CRBN CRISPR/Cas9 Lentivirus.
Two vials (500 µl x 2) of lentivirus at a titer ≥1 x 107 TU/ml. The titer will vary with each lot; the exact value will be provided with each shipment.
Formulation
The lentivirus particles were produced from HEK293T cells. They are supplied in cell culture medium containing 90% DMEM + 10% FBS.
Storage/Stability
Lentiviruses are shipped with dry ice. For long-term storage, it is recommended to store the lentiviruses at -80°C for up to 12 months from date of receipt. Avoid repeated freeze/thaw cycles. Titers can drop significantly with each freeze/thaw cycle.
Applications
Transient knockdown of CRBN in target cell pools
Generation of a stable CRBN knockout cell line following puromycin selection and limiting dilution cloning
Shipping Temperature
-80°C
Notes
Biosafety The lentiviruses are produced with the SIN (self-inactivation) lentivector which ensures self-inactivation of the lentiviral construct after transduction and after integration into the genomic DNA of the target cells. None of the HIV genes (gag, pol, rev) will be expressed in the transduced cells, as they are expressed from packaging plasmids lacking the packing signal and are not present in the lentivirus particle. Although the pseudotyped lentiviruses are replication-incompetent, they require the use of a Biosafety Level 2 facility. BPS Bioscience recommends following all local federal, state, and institutional regulations and using all appropriate safety precautions.
License Disclosure The CRISPR/CAS9 technology is covered under numerous patents, including U.S. Patent Nos. 8,697,359 and 8,771,945, as well as corresponding foreign patent applications, and patent rights.