CBL-B (Human) CRISPR/Cas9 Lentivirus (Non-Integrating)
CBL-B is an E3 ubiquitin-protein ligase which has been identified as a negative regulator of T-cell activation. Using CRISPR/Cas9 to inactivate CBL-B has been shown to be sufficient to inhibit T-cell expansion.
The CBL-B CRISPR/Cas9 Lentiviruses are replication incompetent, HIV-based, VSV-G pseudotyped lentiviral particles that are ready to infect almost all types of mammalian cells, including primary and non-dividing cells. The particles contain a CRISPR/Cas9 gene driven by an EF1A promoter, along with 5 sgRNA (single guide RNAs) targeting human CBL-B driven by a U6 promoter (Figures 1 and 2).
Note: unlike CBL-B CRISPR/Cas9 Lentivirus (Integrating) (BPS Bioscience, #78343), the CBL-B CRISPR/Cas9 Lentivirus (Non-Integrating) is made with a mutated Integrase, resulting in only transient expression of the Cas9 and CBL-B-targeting sgRNA. It is expected that this will minimize potential off-target effects caused by either prolonged expression or random integration of Cas9 and the sgRNA. A short round of puromycin selection right after transduction may increase knockout efficiency, however puromycin should not be used for more than 48 hours post-transduction due to the transient nature of expression using the non-integrating lentivirus.
Figure 1. Schematic of the Lenti-vector used to generate the CBL-B CRISPR/Cas9 Lentivirus
Gene Target: | sgRNA Sequence |
CBL-B | TGTGGGATGTCGACTCCTAG |
CBL-B | CTTCATCTCTTGGATCAAAG |
CBL-B | TTCCGCAAAATAGAGCCCCA |
CBL-B | TGAATTAGATCCAGGCGAGG |
CBL-B | TGCACAGAACTATCGTACCA |
Figure 2. List of sgRNA Sequences in the CBL-B CRISPR/Cas9 Lentivirus
The lentiviruses were produced from HEK293T cells in medium containing 90% DMEM + 10% FBS.