CD47 CRISPR/Cas9 Lentivirus (Non-Integrating)
CD47 (also known as Rh-associated protein, GP42, Integrin-Associated Protein (IAP), or Neurophilin) is an immunoglobulin-like protein that interacts with its receptor, Signal-regulatory protein alpha (SIRPα), on macrophages. This binding interaction regulates transmigration, oxidative burst cytokine production, and phagocytosis, generating a “don’t eat me” signal. CD47 is ubiquitously expressed on the surface of normal cells, but is overexpressed in numerous cancer cells where it is thought to contribute to the resistance of tumors to phagocyte-dependent clearance.
The CD47 CRISPR Lentiviruses are replication incompetent, HIV-based VSV-G pseudo-typed lentiviral particles that are ready to be transduced into almost all types of mammalian cells, including primary and non-dividing cells. The particles contain a CRISPR/Cas9 gene driven by an EF1A promoter, along with 4 sgRNA (single guide RNA) targeting human CD47 (NM_198793.2) driven by a U6 promoter (Figures 1 and 2).
Figure 1. Schematic of the Lenti-vector used to generate the CD47 CRISPR/Cas9 Lentivirus.
Gene Target: | Primer ID: | sgRNA Sequence |
CD47 | CD47-1 | ATCGAGCTAAAATATCGTGT |
CD47 | CD47-2 | GCACTTAAATATAGATCCGG |
CD47 | CD47-3 | AGTGATGCTGTCTCACACAC |
CD47 | CD47-4 | TTTGCACTACTAAAGTCAGT |
Figure 2. List of sgRNA Sequences in the CD47 CRISPR/Cas9 Lentivirus.
Note: unlike human CD47 CRISPR/Cas9 Lentivirus (Integrating) (BPS Bioscience, #78056), the human CD47 CRISPR/Cas9 Lentivirus (Non-Integrating) is made with a mutated Integrase, resulting in only transient expression of the Cas9 and CD47 targeting sgRNA. While this may minimize potential off-targeting risks due to either prolonged expression or integration of the Cas9, puromycin selection should not be used for more than 48 hours post-transduction, which may lower knockout efficiency.
The lentiviruses were produced from HEK293T cells in medium containing 90% DMEM + 10% FBS.