CD47 CRISPR/Cas9 Lentivirus (Integrating)
CD47 (also known as Rh-associated protein, GP42, Integrin-Associated Protein (IAP), or Neurophilin) is an immunoglobulin-like protein that interacts with its receptor, Signal-regulatory protein alpha (SIRPα), on macrophages. This binding interaction regulates transmigration, oxidative burst cytokine production, and phagocytosis, generating a “don’t eat me” signal. CD47 is ubiquitously expressed on the surface of normal cells, but is overexpressed in numerous cancer cells where it is thought to contribute to the resistance of tumors to phagocyte-dependent clearance.
The CD47 CRISPR Lentiviruses are replication incompetent, HIV-based VSV-G pseudo-typed lentiviral particles that are ready to be transduced into almost all types of mammalian cells, including primary and non-dividing cells. The particles contain a CRISPR/Cas9 gene driven by an EF1A promoter, along with 4 sgRNA (single guide RNA) targeting human CD47 (NM_198793.2) driven by a U6 promoter (Figures 1 and 2).
The integrating lentivirus integrates randomly into the cell’s genome to express both the Cas9 and sgRNA. Puromycin selection increases the knockout efficiency by forcing high expression levels of both Cas9 and the sgRNA, and can be used with the integrating lentivirus to quickly and easily achieve high knockdown efficiencies in a cell pool. Efficiencies also depend on the cell type and the gene of interest.
Figure 1. Schematic of the Lenti-vector used to generate the CD47 CRISPR/Cas9 Lentivirus.
Gene Target: | Primer ID: | sgRNA Sequence |
CD47 | CD47-1 | ATCGAGCTAAAATATCGTGT |
CD47 | CD47-2 | GCACTTAAATATAGATCCGG |
CD47 | CD47-3 | AGTGATGCTGTCTCACACAC |
CD47 | CD47-4 | TTTGCACTACTAAAGTCAGT |
Figure 2. List of sgRNA Sequences in the CD47 CRISPR/Cas9 Lentivirus.
The lentiviruses were produced from HEK293T cells in medium containing 90% DMEM + 10% FBS.